None

Galaxy History ' Unnamed history'


DatasetAnnotation
1: reads.fas
3,722 sequences
format: fasta, database: ?
Info: uploaded fasta file
>163895
AGCAAGGCCCAACATTGGTTTTAATTTGCTCATAATAAGAACATAATTAATTAATTAAATTGCATAGGGAGTTAGCGCTACCCGAGGATTCTTCTACATAGCAGGGGGGCCAGTGCTGATGGTGTTGGTCCCAAATAGAGCAGCTTGCGGTGCCGCCCCATGGAAACTTGGGGTATCTGGTCGCTGTAGCCATAGCTCAACCGGTCGTGGCCTTAGACGAGATACGCGCGGCTACTATCAGGGTGTCGACACACCG
GGAGGTCTTGCTGGACTTATTTTACCATTGTCGAAATGTCTTGTGCACAGGGATGCCGAGCCTGATCGGTTTTTGTTGGGGAACGTAGCAGAATTCAAAAAATTTCCTACGCTTCACCAAGATCAATCTAAGGAGTCATCTAGCAACGAGCATAATAGAGTGCATCTACATACCCTTTTGTAGATTGCGTGCGGAAGCGTTCGAAGGAACGTGGATGAAGTAGTCGTACTCTTCGCGATCCTCGTCACCGATGATC
CCAGCGCAG
>161549
ACATGTACAACTACGACCCGAGACCGGCAAGACCGCTACGATCGTGAACGACTACCGTCGCCCCGTGTACCACTACTTCCCTCTACGGAACGACTACTCGTTGGCGACCTCGTGAACGGCTACTTCCTCTCCGAACGTGAACGACTACGTTCCTCGACGACTCGAACCGCCCCGAAAAGAACGCTTCAAAGGTATAGCCCCGAGACGATGACTCGTGGAATGCTTGTTGTGTTGTATGAAATGTCTCCCGTGTGTG