None
Published Histories | andreiaac2 | Copy of 'DNA repetitivo'
Import history

Galaxy History ' Copy of 'DNA repetitivo''


DatasetAnnotation
1: Galaxy57-[Select_first_on_data_1].fastqsanger
786.4 MB
format: fastqsanger, database: ?
Info:
uploaded fastqsanger file
@M00971:9:000000000-A4EFL:1:1101:15909:1704 1:N:0:1
ACTTAAGATATAATACATACAATTTAATAATTTTCTTCAAATTATGTATTAATTTTTATAAAATATTAATATAACTTTTCTAATATTTAATAATTTATTTAATGTATGATTG
+
1>>A1111B1B33B3B1B3B11DFG33D33DGGHGGHG313DF1F2GBGH22DGGHHAGB221D1GHB2FFHB2FGHHHFHB2FDGHHB2F22FGHBGHHBBFFGBGD2GHF
@M00971:9:000000000-A4EFL:1:1101:15983:1716 1:N:0:1
CTACAGGTTTCAAACTTTGGTACATTGGGAAAGTCAGAGGAAGGAATGGAGTTGATATAATTGTAGATAAGATTTGGAAGAAGAATGTGATATATGTAAAAAGGATTGGGGATAGGATCTTATC
2: R1.fastq
984.6 MB
format: fastqsanger, database: ?
Info:
uploaded fastqsanger file
@M00971:6:000000000-A30TU:1:1101:14768:1786 1:N:0:4
GTATTTACTCTGACATCTCTAAGTCTGGTAAAGCTAGCTCTGGATGACTGGATCGGCTTCCTTTCTGATTGAAACCTTTCATAAGCAATGTTCCACTCAAGAGGCTGTCTCTTATACACTTTTCCGGGCCCACGGAACTAAGGGGATTCCCGTTTCCCGCTTCTTCTTTACAAAAAAAAACACCCCATTTTTTTTTTTTTTTTTTTTTTTTCCCTTTTCCTTCCCTTTTCGCATTGGCCCCTCCGGGCGCG
+
>A1>AF3@DFFF1F1GGGGGFBDGFHFCGB31DAGFBFGFHGH1GH1AGFFCDGEEEGGHGHHFFEG2GFBGHHHHHH1F2DF21FF0DD22F2211BC@B1B//>0B@22BF1B2F2@1B11@1///>E///<////1<1100/?/0121//00121///?/11111111<=D0F--<-...:.:.:0000---------9----9---9/999///99//9/9/999B-----////--:---;;--;-
@M00971:6:000000000-A30TU:1:1101:12909:1801 1:N:0:4
ACGTAACAGTATCAACTATCATGAGTGACTCTACAAGGATTTGACTTTTAGAGGGATTCACTTTAGAGAAAAAAGTGAGAACCGTTAATCATTGACAAGAAATTCACCAAAGGGATTTCTAACAAATTCATAGTTCATCTCAATGGGCATGGATTTTTTAAAAATTTGAACCGTTAATCTTTTCCTTATTTTTTTTTTTTTTTTTTTTTTCCCCTTTTTTTTCTTTTTTCCCGTACCCCCCTTTTGGCCC
3: Compute quality statistics on data 2
252 lines
format: txt, database: ?
column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count Max_count
1 1996586 2 36 65119209 32.62 32 33 34 2 29 36 534991 451691 746726 261703 1475 1996586
2 1996586 2 36 65633732 32.87 32 33 34 2 29 36 445445 418817 278568 852281 1475 1996586
3 1996586 2 36 66216737 33.16 33 33 34 1 32 35 561000 471813 299683 662615 1475 1996586
4 1996586 2 36 65802094 32.96 33 33 34 1 32 35 375337 511854 198499 909421 1475 1996586
5 1996586 2 36 65341015 32.73 32 33 34 2 29 36 816787 184518 176623 817183 1475 1996586
4: Compute quality statistics on data 1
252 lines
format: txt, database: ?
column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count Max_count
1 2500000 2 36 81791604 32.72 32 33 34 2 29 36 764008 530242 840745 360656 4349 2500000
2 2500000 2 36 82230839 32.89 32 33 34 2 29 36 617360 490409 322467 1065415 4349 2500000
3 2500000 2 36 82827526 33.13 33 33 34 1 32 35 748787 549326 326526 871012 4349 2500000
4 2500000 2 36 82755185 33.10 33 33 34 1 32 35 506404 574715 223689 1190843 4349 2500000
5 2500000 2 36 82753763 33.10 33 33 34 1 32 35 1056499 197311 194126 1047715 4349 2500000
6: Draw quality score boxplot on data 4
33.3 KB
format: png, database: ?
Image in png format
7: Draw quality score boxplot on data 3
40.1 KB
format: png, database: ?
Image in png format
8: Draw nucleotides distribution chart on data 4
18.6 KB
format: png, database: ?
Image in png format
9: Draw nucleotides distribution chart on data 3
17.9 KB
format: png, database: ?
Image in png format
10: Filter FASTQ on data 2
12.1 MB
format: fastqsanger, database: ?
Info:
Kept 61432 of 1996586 reads (3.08%).
@M00971:6:000000000-A30TU:1:1101:15341:1914 1:N:0:4
ATTAAAACTTCATTAAACAACTTCATACTAGAATTTACATAAATAATTATTATCATCCATGTAAAATCAAAACC
+
AAA?AD5BFFFFGGGGGGGGGGHHHHGGHGGH5GGHCHGHHGHHGHHHHHHHHHHHHGFFFHHGHFGFHHHGHG
@M00971:6:000000000-A30TU:1:1101:17370:1986 1:N:0:4
GAATTAATACTAATAACATGTTGTAGATTTGCAGGCCAAACAAGGTTCTCTCCCTTGATA
11: Filter FASTQ on data 1
496.0 MB
format: fastqsanger, database: ?
Info:
Kept 1554961 of 2500000 reads (62.20%).
@M00971:9:000000000-A4EFL:1:1101:12792:1828 1:N:0:1
TTATATCAATGGTCAAAAATATTTGAAGTTGTTGAACATTGATTTTTACCCAAAATAATTGAAACTTATTAAATTAAAAACTATAACCAAACTTCTTAGATAAAATGACGATAACTTAGCTTGCAAG
+
ABAAAFFF5FFBGFFGBFAGFGHHF6DBGGFHHCBFGFGHC5GGHHHHHFGHAFAFBFGHB55EFHHGHHHFBGHHHEFBEGHHHGHGHEEHGHHHHGHGHHHHGHHEHFEGGFFHHGDEHHGHFEG
@M00971:9:000000000-A4EFL:1:1101:15928:1831 1:N:0:1
CCCTCTGTGTTTTAGCCTAATAACCCTTGTGCAAGCATGTTATAGGAAGTTAGGGAGTTTTCAAAGACTTATGTTGATGTTGTGAATCATGGAG
12: fastq dataset 11 with modified sequence names
485.6 MB
format: fastq, database: ?
@M00971:9:000000000-A4EFL:1:1101:12792:18281
TTATATCAATGGTCAAAAATATTTGAAGTTGTTGAACATTGATTTTTACCCAAAATAATTGAAACTTATTAAATTAAAAACTATAACCAAACTTCTTAGATAAAATGACGATAACTTAGCTTGCAAG
+
ABAAAFFF5FFBGFFGBFAGFGHHF6DBGGFHHCBFGFGHC5GGHHHHHFGHAFAFBFGHB55EFHHGHHHFBGHHHEFBEGHHHGHGHEEHGHHHHGHGHHHHGHHEHFEGGFFHHGDEHHGHFEG
@M00971:9:000000000-A4EFL:1:1101:15928:18311
CCCTCTGTGTTTTAGCCTAATAACCCTTGTGCAAGCATGTTATAGGAAGTTAGGGAGTTTTCAAAGACTTATGTTGATGTTGTGAATCATGGAG
13: fastq dataset 10 with modified sequence names
11.7 MB
format: fastq, database: ?
@M00971:6:000000000-A30TU:1:1101:15341:19142
ATTAAAACTTCATTAAACAACTTCATACTAGAATTTACATAAATAATTATTATCATCCATGTAAAATCAAAACC
+
AAA?AD5BFFFFGGGGGGGGGGHHHHGGHGGH5GGHCHGHHGHHGHHHHHHHHHHHHGFFFHHGHFGFHHHGHG
@M00971:6:000000000-A30TU:1:1101:17370:19862
GAATTAATACTAATAACATGTTGTAGATTTGCAGGCCAAACAAGGTTCTCTCCCTTGATA
14: FASTQ to FASTA on data 12
1,554,961 sequences
format: fasta, database: ?
Info:
1554961 FASTQ reads were converted to FASTA.
>M00971:9:000000000-A4EFL:1:1101:12792:18281
TTATATCAATGGTCAAAAATATTTGAAGTTGTTGAACATTGATTTTTACCCAAAATAATTGAAACTTATTAAATTAAAAACTATAACCAAACTTCTTAGATAAAATGACGATAACTTAGCTTGCAAG
>M00971:9:000000000-A4EFL:1:1101:15928:18311
CCCTCTGTGTTTTAGCCTAATAACCCTTGTGCAAGCATGTTATAGGAAGTTAGGGAGTTTTCAAAGACTTATGTTGATGTTGTGAATCATGGAG
>M00971:9:000000000-A4EFL:1:1101:15075:18381
ATATATTATCATGAGAAACTTGATATTTGAATTTTCTACACTTTTTTCCCATAGGGAACAAATACATATTGGGAATATGAT
15: FASTQ to FASTA on data 13
61,432 sequences
format: fasta, database: ?
Info:
61432 FASTQ reads were converted to FASTA.
>M00971:6:000000000-A30TU:1:1101:15341:19142
ATTAAAACTTCATTAAACAACTTCATACTAGAATTTACATAAATAATTATTATCATCCATGTAAAATCAAAACC
>M00971:6:000000000-A30TU:1:1101:17370:19862
GAATTAATACTAATAACATGTTGTAGATTTGCAGGCCAAACAAGGTTCTCTCCCTTGATA
>M00971:6:000000000-A30TU:1:1101:15562:20682
GATTCTCACTATCATTCTAAAATAATTTTGGTTATATTTAAATGTTTTAGACTTGTTTGGTGTGCCATATAAGATAAAAATAAATAATATAATATAA
16: Trim sequences on data 15
61,432 sequences
format: fasta, database: ?
Info:
Trimming: base 21 to 60
Input: 61432 reads.
Output: 61432 reads.
>M00971:6:000000000-A30TU:1:1101:15341:19142
CTTCATACTAGAATTTACATAAATAATTATTATCATCCAT
>M00971:6:000000000-A30TU:1:1101:17370:19862
TTGTAGATTTGCAGGCCAAACAAGGTTCTCTCCCTTGATA
>M00971:6:000000000-A30TU:1:1101:15562:20682
AATAATTTTGGTTATATTTAAATGTTTTAGACTTGTTTGG
17: Trim sequences on data 14
1,554,961 sequences
format: fasta, database: ?
Info:
Trimming: base 21 to 60
Input: 1554961 reads.
Output: 1554961 reads.
>M00971:9:000000000-A4EFL:1:1101:12792:18281
ATTTGAAGTTGTTGAACATTGATTTTTACCCAAAATAATT
>M00971:9:000000000-A4EFL:1:1101:15928:18311
TAACCCTTGTGCAAGCATGTTATAGGAAGTTAGGGAGTTT
>M00971:9:000000000-A4EFL:1:1101:15075:18381
TGATATTTGAATTTTCTACACTTTTTTCCCATAGGGAACA