None
Published Histories | jirka | Adelhaide_kratzmarii_FIRST_CLUST
Import history

Galaxy History ' Adelhaide_kratzmarii_FIRST_CLUST'


DatasetAnnotation
1: reads.merged2
89,405 sequences
format: fasta, database: ?
Info: uploaded fasta file
>PST_14186305f
TGTCTGATTCTTTCACTCCGATTAATAAAAATGAAGACAAGTATTTAAAAAATCGCAAAAAGAGTTGCAACACAAAGACTTTCCATGAGGCCACTCATCT
>PST_4809211r
AATCGGACGAAGTATGAGAAAAAAAATATTCAGCGTTAGTTACATTTATTTTTCCGTTAATAAGTGAAAGAAATCAATTATATACAACTAGAGCGCATTG
>PST_6082768r
GATACCGAATGCGTTCTAATTGTATATATTTAATTTATTTCACTTATTAACGGAAAAATAAATATAACGAACGCTGAAATATTTATTTTCTCTTACTTTG
2: Archive with clustering results from dataset 1
1,771,723 lines
format: zip, database: ?
binary/unknown file
3: Contigs from dataset 1 based on clustering
2,166 sequences
format: fasta, database: ?
>CL1Contig1 (148-2.0-296)
AATGTTGTACCTTCTTTGTAACTTTACCGCATTTCTAATAAATCCGGATAAAGAATGTAT
ACAAATACAATATTTTAAGATAAATGTGGTTCCTTCTTTGTAATTTACCATATTTCATAA
CAAATGAATGAAACACAAGCATAACACA
>CL1Contig2 (100-2.0-200)
TTTAACACAACCATTTTTAGACAAATGTTGCACCTTTTATTGTAATTTTATCGCATTTCA
4: Log information of clustering based on dataset 1
2,296 lines
format: txt, database: ?
False
This is clustering pipeline
GRAPH BASED CLUSTERING
**********************************************************************
Data preparation started:
5: HTML summary of graph based clustering on dataset 1
33.8 KB
format: html, database: ?
HTML file