None
Published Histories | jirka | Adelhaide_kratzmarii_RECLUST
Import history

Galaxy History ' Adelhaide_kratzmarii_RECLUST'


DatasetAnnotation
1: reads.merged2
89,405 sequences
format: fasta, database: ?
Info: uploaded fasta file
>PST_14186305f
TGTCTGATTCTTTCACTCCGATTAATAAAAATGAAGACAAGTATTTAAAAAATCGCAAAAAGAGTTGCAACACAAAGACTTTCCATGAGGCCACTCATCT
>PST_4809211r
AATCGGACGAAGTATGAGAAAAAAAATATTCAGCGTTAGTTACATTTATTTTTCCGTTAATAAGTGAAAGAAATCAATTATATACAACTAGAGCGCATTG
>PST_6082768r
GATACCGAATGCGTTCTAATTGTATATATTTAATTTATTTCACTTATTAACGGAAAAATAAATATAACGAACGCTGAAATATTTATTTTCTCTTACTTTG
2: Archive with clustering results from dataset 1
1,771,723 lines
format: zip, database: ?
binary/unknown file
3: Contigs from dataset 1 based on clustering
2,166 sequences
format: fasta, database: ?
>CL1Contig1 (148-2.0-296)
AATGTTGTACCTTCTTTGTAACTTTACCGCATTTCTAATAAATCCGGATAAAGAATGTAT
ACAAATACAATATTTTAAGATAAATGTGGTTCCTTCTTTGTAATTTACCATATTTCATAA
CAAATGAATGAAACACAAGCATAACACA
>CL1Contig2 (100-2.0-200)
TTTAACACAACCATTTTTAGACAAATGTTGCACCTTTTATTGTAATTTTATCGCATTTCA
4: Log information of clustering based on dataset 1
2,296 lines
format: txt, database: ?
False
This is clustering pipeline
GRAPH BASED CLUSTERING
**********************************************************************
Data preparation started:
5: HTML summary of graph based clustering on dataset 1
33.8 KB
format: html, database: ?
HTML file
6: HTML summary of read pairs analysis on dataset 2, cutoff=0.01
3.9 KB
format: html, database: ?
HTML file
7: clusters_to_merge_2
9 lines
format: txt, database: ?
Info: uploaded txt file
8 12 14 15 16 19 33 37 41 46 50
20 28 29 32 42 45 47 49 51
13 23 27 35 36
17 30 38 39 40
4 10 25 34
5 6 11 44
8: Archive with clustering results from dataset 2
1,712,863 lines
format: zip, database: ?
binary/unknown file
9: Contigs from dataset 2 based on clustering
2,096 sequences
format: fasta, database: ?
>CL1Contig1
CGCGGAGGACTCGACCAAACACTACTAAACTTTGCATATCCCATACTTATCTTGGGAGAT
AACTCCATGCAAAAAATCAGCTCAAAATGCAACGCATAGCCCACGGTTTGAGTGCAATGC
ATAACCCA
>CL1Contig2
GCTTCCGTCGCCTACTGAGCGTCTGTGCCTCGAAAGGCCGAAATATCGATGGATCGCCCG
10: Log information of clustering based on dataset 2
1,108 lines
format: txt, database: ?
This is re-clustering pipeline
Extracting original clustering data:
Evaluating connection between clusters
2013-01-28 16:16
Evaluating mate pairs
11: HTML summary of graph based clustering on dataset 2
13.2 KB
format: html, database: ?
HTML file
14: Archive with clustering results from dataset 2
1,717,974 lines
format: zip, database: ?
PK
15: Contigs from dataset 2 based on clustering
943 sequences
format: fasta, database: ?
>CL1Contig1
ACGCATAGCCCACGGTTTGAGTGCAATGCATAACCCACGGTTTGAGTGGAGAGCATTTTG
ACCCCGAAAAATAGAAAACGCGCGGAGGACTCGACCAAACACTACTAAACTTTGCATATC
CCATACTTATCTT
>CL1Contig2
CCTTTGAGAGGCCGACCCCCGAAAAATCAGAAACACATCGATGGTTCGTGTAATGCATAG
16: Log information of clustering based on dataset 2
1,162 lines
format: txt, database: ?
This is re-clustering pipeline
Extracting original clustering data:
input parameters:
WD=/mnt/raid_galaxy/home/galaxy/galaxy-dist/tools/umbr_programs/seqclust/programs
DATA=
17: HTML summary of graph based clustering on dataset 2
13.5 KB
format: html, database: ?
HTML file