None

Galaxy History ' 802'


DatasetAnnotation
1: SRR942802.fasta
20,302,289 sequences
format: fasta, database: ?
Info:
uploaded fasta file
>1
AAACTTTTGAACCTTTCTTTTAACATTCCGATGCACTGATCTATGCGTACTCTGTATTTAAGGCATCCTTCTCGGATGCTTCGCCTTCTTTCCTGCGCCATNAGCTNAACCNNNNNNNNNNNNNGCGNNNNCTTCTATANGGAGNNNCNNNNNNNNGCCATTGTCAGACTTTGTCGCCACTGGTCGACGTCCTGCAGCCTAC
>2
GTATATATGAATACATATAATAAATGATATTTCAATAATTTTCAAACAACAAAAAGGTTCAAGCAATGTTTTTCTGAAAAAAGAAGTAAAACCCAAACGAATGATCNAATANNNNNNNNNNNNNAAGNNNNGCCCAAAANTCCTNNNATTNNNNNCAGTTATAAACAAGAATGCCAACCCTCTTACAACTTCAGAACATTAG
>3
AGGGAAGAACAAGAATCACCAGACCACGCAGAAATAGACTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
6: SRR942798.fasta
40,631,298 sequences
format: fasta, database: ?
Info:
uploaded fasta file
>1
NAGACTGCCGTTAGCAGATCCTGACTTTCGGCAACCAGGACTCATTGACCACACCGCGGGACAAGGGGGAAATGAGCACTTGACGCTGGCACGGGGAC
>2
ATGTTTCATTAATTATAATTAACTAGCGACTTCCAATCCGATGTCATTACCCACACCGACTTTTTCTCCTCCGCTGACTTTTACAAAAGTCTTCATCG
>3
CATATGTCTTTCAAATGACGAGCTTAACTTGTCCACCAATACCTAGAATAGGCCGGTTGGACGATTACGGTCCAAGGTGTGGTGGCCACAAATAGATC
13: Archive with clustering results from dataset 6
25.1 GB
An error occurred running this job: Cluster could not complete job
14: Contigs from dataset 6 based on clustering
85.0 MB
An error occurred running this job: Cluster could not complete job
15: Log information of clustering based on dataset 6
7.1 KB
An error occurred running this job: Cluster could not complete job
16: HTML summary of graph based clustering on dataset 6
30.7 KB
An error occurred running this job: Cluster could not complete job