None

Galaxy History ' 99'


DatasetAnnotation
1: SRR942799.fasta
97,754,194 sequences
format: fasta, database: ?
Info:
uploaded fasta file
>1
GNCTATTTTCTCTTATCTTAAAATATATCGAAATATTATCGTATTCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
>2
ANAGTGCCTACCCTCCGCTTTTATTGACGAACCCGTCAATGGGGGGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
>3
CNAAATTTAAATTGTTGCTGAAAAGTGTGTTGTTTCCGCCCACAATACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
6: Archive with clustering results from dataset 1
40,758,925 lines
format: zip, database: ?
PK
7: Contigs from dataset 1 based on clustering
78,137 sequences
format: fasta, database: ?
>CL1Contig1 (98-9.1-888)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAACCGGATCTCGTTGGAGGGGGGGG
AGGCTGGTGGGGGGAGAGGGGGGGGGTCTGTCGGGGCG
>CL1Contig2 (98-10.4-1021)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAACCGATCTCGTATGATTGGGAAGG
CGGCGGGTAGGGGAAGAGGGGGAGTTTCGGGGGGCGCC
8: Log information of clustering based on dataset 1
1,447 lines
format: txt, database: ?
pipeline version:
d5204b9a1621+ 163+ stable
This is clustering pipeline
GRAPH BASED CLUSTERING
**********************************************************************
9: HTML summary of graph based clustering on dataset 1
11.3 KB
format: html, database: ?
HTML file