None

Galaxy History ' 803'


DatasetAnnotation
1: SRR942803.fasta
22,077,964 sequences
format: fasta, database: ?
Info:
uploaded fasta file
>1
TTTGGGTTTTGCCGGTGCCCGAGTTTCCAATGAGCTNTACAATCTGACCCAGGGGTTTGCTACCTCCGAAATGAGTGTCCTGGCTGTTNNTCNNNGTCAGTGCTGATTTTGACAGCTGGTAACTTAACATTGCATGTTAGCAGATAACTTACTGTTAAATAATATGGCGCGTATGTTTTTTCGGTCTTTCGTTTTTTCGGTC
>2
AAGTCAAGTTTCAACAAGTATTATAATGTCATAATAGCTTTTAGAAGTGTTCATAAAGACAAATTGCGTTTTGGTTCTCATGGATATAATGGATATATTTATATACAAGAGACCGTAAGAAAATCTCTAACTTATTACCCACTCGACTGCACTCTTTTTGATGACGCACTTTCGATGGCCCTCACCGTATTAAAAACAGTTC
>3
AATTTCACTGCCCGATTTTGCTTTCTCTGCATGAGTGTGTGTCTGAATCAAATGCACATTTGGCACACACCCTCACCCTGCACTCGCAATCTGCAATCCGCAAATTGATGATGTCACTTGATAGGGCGAATGGGTTTTTCATTTTTCACTTCTCGCTCTCGTCCGTACCCCTGCCCAATCTCCGGGGGTCCTGCAGATCCTC
6: Archive with clustering results from dataset 1
0 bytes
An error occurred running this job: This job was stopped by an administrator: computation time exceeded. <a href='http://wiki.galaxyproject.org/Support' target='_blank'>Contact support</a> for additional help.
7: Contigs from dataset 1 based on clustering
0 bytes
An error occurred running this job: This job was stopped by an administrator: computation time exceeded. <a href='http://wiki.galaxyproject.org/Support' target='_blank'>Contact support</a> for additional help.
8: Log information of clustering based on dataset 1
7.0 KB
An error occurred running this job: This job was stopped by an administrator: computation time exceeded. <a href='http://wiki.galaxyproject.org/Support' target='_blank'>Contact support</a> for additional help.
9: HTML summary of graph based clustering on dataset 1
0 bytes
An error occurred running this job: This job was stopped by an administrator: computation time exceeded. <a href='http://wiki.galaxyproject.org/Support' target='_blank'>Contact support</a> for additional help.