None
Published Histories | ww95 | FaJa L002R1/2 + MuAu L002R1
Import history

Galaxy History ' FaJa L002R1/2 + MuAu L002R1'


DatasetAnnotation
25: MuAu-bc6_S4_L002_R1_001.fasta
5,447,693 sequences
format: fasta, database: ?
Info:
uploaded fasta file
>NS500162:113:H2TNVAFXX:2:11101:14856:1013_1:N:0:4
NCAGANTGTTGCAAAAGGCCGAGTACAATGCTGCTAGAGCCAACAAAGGGAGGCGTCAAGTTTCTTTCCAGCCTGGTGATTTGGTGTGGGTACATCTAAGGAAGGAGAGGTTTCCAGTGCAGCGGTATTCTAAGCTGGCTCCGCGTGGTG
>NS500162:113:H2TNVAFXX:2:11101:9494:1013_1:N:0:4
NCTCCNCACCCAACTGACATTCTTATTCTTGGTGACATCCTATATACTTCTCCCTTTTAGGAAATTGCTCGTGGCCCATTCTGTCCAAATATTAGGAGTTTTTTGGACGATGTCATGAACTAAGCTTGAAATTTGCGCTCTGTTCCAAGTC
>NS500162:113:H2TNVAFXX:2:11101:12935:1013_1:N:0:4
NTGAGNTACAAGATTTGTTCTTCGCCCATCCACATTCGAGGCATTTGATGAAGAGGTTCCCGTACGACGTCATCATGGACACCACGTACAAGAAAAATGAGTAAGATTTGGCTATTAAGCTCATTAGCTTATTGAATACGGTTTCGGTAA
36: Archive with clustering results from dataset 25
59,882,780 lines
format: zip, database: ?
PK
37: Contigs from dataset 25 based on clustering
444,555 sequences
format: fasta, database: ?
>CL1Contig1 (365-6.5-2370)
GGTGTTCTTCCATGATGGATATCCGTCCGAGGCATTGGCCGGGTTATCTCCTGTGTTACG
CGGCCGCTTTCCAGAAGGATACCCGACCGGGTCTTCGACCGGGTCTTTGGCCGGGTGTTC
TCCTGGGCCGCCGCCTTAGGTTATTTTTGGTTATTTTTGTACCTTTTCTTTTAGGTTAGT
ATTTAAACCCTTCTTTTAGGTTTTAGAAGGGATCTGATCTTATCTTTTACTATTGTCAAG
TTAGAAAACTCTCAAGAGATTGGAGATTGAACTATTCTGTCAGAGATTGAAGTTCTGTAA
38: Log information of clustering based on dataset 25
13,963 lines
format: txt, database: ?
pipeline version:
d5204b9a1621 163 stable
This is clustering pipeline
GRAPH BASED CLUSTERING
**********************************************************************
39: HTML summary of graph based clustering on MuAuL002R1 - dataset 25
223.3 KB
format: html, database: ?
HTML file
45: FaJa-bc5_S3_L002_R1_001.fasta
6,544,578 sequences
format: fasta, database: ?
Info:
uploaded fasta file
>NS500162:113:H2TNVAFXX:2:11101:11646:1013_1:N:0:3
NTGTTNCTTCTTAACAACTCATGCTGTAACATTGGTTGCATTGTAAGCATGGAAACCATATCTTCCTGTGGAGTTTTACTACTTAAGGCGTCATCCACAACATTGGCTTTTCCCTGATGGTAGAGCAGTTCAATGTCGTAGTCCTTTAGC
>NS500162:113:H2TNVAFXX:2:11101:11174:1014_1:N:0:3
NAATCNTCTTTTGAGTTGTCCCCATAATCACATGAGCCAGAAACAAATCGTGACTTACCCCGAGTTGGGACATATTAGGATCTCGTCATTATTATACATTATTTTAGATTTGTTTTGATGAGTGGCCTATTCCCTCTGAGTACAAGGGGCT
>NS500162:113:H2TNVAFXX:2:11101:25499:1014_1:N:0:3
NATTANGCTTTTCCTACTAATGAACAGTTGTTGGAAGAATTCATATTTAACCTGTTTCCTGGTTGTTACGTCTGGTTTTGGTTTATCCACAAAAGGATTTAGATCCTTGCGAGTTTGAGACTTGTTATTCGGTGCTTGCTTGAAGACGGTT
46: Archive with clustering results from dataset 45
51,389,301 lines
format: zip, database: ?
PK
47: Contigs from dataset 45 based on clustering
386,662 sequences
format: fasta, database: ?
>CL1Contig1 (264-30.4-8033)
GTTTCCCAAGTTGTACTAACCATCCTGGTTCATTAATTATTGGGCATTGGACCCTTATCT
TTCATTAATTACAAAACACGACAACTTCATTAGAATATTTACAAATTCGACATTCTAGAA
GAATAGTCGAATACCAGCTTCTTTCCTCTGAAGTACTCCCGGCCTCTTTCATCCGGATTG
TTCTCGGTCTCTTTCACCCGAATGGTTCCCGGTCTCTTTCACCCGGATGGTTCCCGGTCT
CTTTCACCCGGATGGTTCCCGGTC
48: Log information of clustering based on dataset 45
17,410 lines
format: txt, database: ?
pipeline version:
d5204b9a1621 163 stable
This is clustering pipeline
GRAPH BASED CLUSTERING
**********************************************************************
49: HTML summary of graph based clustering on FaJaL002R1-dataset 45
255.5 KB
format: html, database: ?
HTML file
50: FaJa-bc5_S3_L002_R2_001.fasta
6,544,578 sequences
format: fasta, database: ?
Info:
uploaded fasta file
>NS500162:113:H2TNVAFXX:2:11101:11646:1013_2:N:0:3
GACACTACTTATATGGAGTAAGGTGCCTGGTTTTCACAGATCACAAGCTCCTCCAATATGTTTTCACTCAAAAGGAACTGAACATGAGTTAGAGAAGGTGGNTA
>NS500162:113:H2TNVAFXX:2:11101:11174:1014_2:N:0:3
GAAAGACGCAACGACGTCTCCTAGCCCCTTGGGCTCGGAGGGAATAAGTCAATTCCTCGGATGACACAGTGATGTCTTCGGGCTCGGAGGGAACAAGTCGACTCNNCNN
>NS500162:113:H2TNVAFXX:2:11101:25499:1014_2:N:0:3
ACTTGAACCAGATTTAGTGATTTACCAAATCATTACTTTCGCTATAGTATTCTAGACCTGTCCACATGCAAATTTAAACACCTTCCTTTCCCCACTTGATTCAGN
52: Contigs from dataset 50 based on clustering
465,205 sequences
format: fasta, database: ?
>CL1Contig1 (322-8.2-2639)
AAATTCAATAAATATAAAATAATTTAATTTTTCTTTTATTATTATTGAGTAAGATTAATA
ACCTTTTGGGTAAGGTCCAAAGTAGCAACATAACCTTATATAGGTTATAATTAAATTTTC
TCAATTTAAGAAAATAATGCCATTACTTTTATTATTTGGCTAATATAAATTTCCAACTTC
ATATTTAACCAAATAAATCGTTTAAGTCCTAACTTGACTTTAAAAGTAGTTTTCCTTATT
ACTTTTTATCCATTATTATTTTAGAAATAGATTTTAGACAAGAAGTAATTAAAAAATTTC
53: Log information of clustering based on dataset 50
18,252 lines
format: txt, database: ?
pipeline version:
d5204b9a1621 163 stable
This is clustering pipeline
GRAPH BASED CLUSTERING
**********************************************************************
54: HTML summary of graph based clustering on dataset 50
270.6 KB
format: html, database: ?
HTML file
59: RT Protein domain search on FaJaL2R1dataset 47
8,256,703 lines
format: fasty36, database: ?
Info: Fallopia japonica
fasty36 -m 3 -m9 -b 1 -H -q -O output.part.0 - /mnt/raid_galaxy/home/galaxy/galaxy-dist/tool-data/domains/TE_domains_newest_RT
FASTY compares a DNA sequence to a protein sequence data bank version 36.06 Sep, 2010
Please cite:
Pearson et al, Genomics (1997) 46:24-36
Query: CL1Contig1, 264 aa
60: RT domain search on dataset MuAuL002R1
9,482,610 lines
format: fasty36, database: ?
fasty36 -m 3 -m9 -b 1 -H -q -O output.part.0 - /mnt/raid_galaxy/home/galaxy/galaxy-dist/tool-data/domains/TE_domains_newest_RT
FASTY compares a DNA sequence to a protein sequence data bank version 36.06 Sep, 2010
Please cite:
Pearson et al, Genomics (1997) 46:24-36
Query: CL1Contig1, 365 aa
61: CHDII domain search on dataset FaJaL002R1
8,129,225 lines
format: fasty36, database: ?
fasty36 -m 3 -m9 -b 1 -H -q -O output.part.0 - /mnt/raid_galaxy/home/galaxy/galaxy-dist/tool-data/domains/TE_domains_newest_CHDII
FASTY compares a DNA sequence to a protein sequence data bank version 36.06 Sep, 2010
Please cite:
Pearson et al, Genomics (1997) 46:24-36
Query: CL1Contig1, 264 aa
62: Protein domain search on dataset 37
9,346,803 lines
format: fasty36, database: ?
fasty36 -m 3 -m9 -b 1 -H -q -O output.part.0 - /mnt/raid_galaxy/home/galaxy/galaxy-dist/tool-data/domains/TE_domains_newest_CHDII
FASTY compares a DNA sequence to a protein sequence data bank version 36.06 Sep, 2010
Please cite:
Pearson et al, Genomics (1997) 46:24-36
Query: CL1Contig1, 365 aa
75: transfer of dataset 25 to ftp server status
8 lines
format: txt, database: ?
data set: MuAu-bc6_S4_L002_R1_001.fasta
size of dataset : 1104029635 bytes
transfer started
Mon, 11 Jul 2016 12:18:06
data set was successfully transfered to ftp server
Mon, 11 Jul 2016 12:18:08
76: transfer of dataset 36 to ftp server status
8 lines
format: txt, database: ?
data set: Archive with clustering results from dataset 25
size of dataset : 17029960741 bytes
transfer started
Mon, 11 Jul 2016 12:19:08
data set was successfully transfered to ftp server
Mon, 11 Jul 2016 12:20:01
77: transfer of dataset 37 to ftp server status
8 lines
format: txt, database: ?
data set: Contigs from dataset 25 based on clustering
size of dataset : 107089084 bytes
transfer started
Mon, 11 Jul 2016 12:19:47
data set was successfully transfered to ftp server
Mon, 11 Jul 2016 12:19:47
78: transfer of dataset 45 to ftp server status
8 lines
format: txt, database: ?
data set: FaJa-bc5_S3_L002_R1_001.fasta
size of dataset : 1326303492 bytes
transfer started
Mon, 11 Jul 2016 13:18:25
data set was successfully transfered to ftp server
Mon, 11 Jul 2016 13:18:27
80: transfer of dataset 46 to ftp server status
8 lines
format: txt, database: ?
data set: Archive with clustering results from dataset 45
size of dataset : 14559055820 bytes
transfer started
Mon, 11 Jul 2016 13:20:33
data set was successfully transfered to ftp server
Mon, 11 Jul 2016 13:21:37
81: transfer of dataset 47 to ftp server status
8 lines
format: txt, database: ?
data set: Contigs from dataset 45 based on clustering
size of dataset : 96082925 bytes
transfer started
Mon, 11 Jul 2016 13:21:37
data set was successfully transfered to ftp server
Mon, 11 Jul 2016 13:21:37
82: transfer of dataset 52 to ftp server status
8 lines
format: txt, database: ?
data set: Contigs from dataset 50 based on clustering
size of dataset : 115533811 bytes
transfer started
Mon, 11 Jul 2016 13:22:42
data set was successfully transfered to ftp server
Mon, 11 Jul 2016 13:22:42
83: transfer of dataset 50 to ftp server status
8 lines
format: txt, database: ?
data set: FaJa-bc5_S3_L002_R2_001.fasta
size of dataset : 1325900366 bytes
transfer started
Mon, 11 Jul 2016 13:33:31
data set was successfully transfered to ftp server
Mon, 11 Jul 2016 13:33:34